Human Variation and Race Blog

Human Variation and Race Blog

High altitude affects the survival of humans negatively because even though high altitude and the sea level have the same percentage of oxygen, high altitude’s air pressure is 30% lower because the atmosphere is less dense.  This means, that the air molecules are farther apart.  At high altitudes, since the air pressure is lower it makes it more difficult for oxygen to enter our vascular systems and the result of this is hypoxia or oxygen deprivation.  Hypoxia usually starts with not being able to do normal physical activities such as climbing a set of stairs.  There can also be a lack of appetite, distorted vision, and difficulty with memorizing and thinking clearly.  If you are not able to adjust to high altitudes say when you go on a vacation, you may develop some symptoms that will let you know that you need to go back down to sea level.  In some serious cases, high altitude can lead to a fatality if the person cannot acclimatize correctly.  This environmental stress negatively affects the survival of humans because our body is not equipped to handle such drastic climate changes.  Our body is more susceptible to health problems in higher altitudes because of the fall in atmospheric pressure.  

Our bodies do a short-term adaptation to high altitudes by acclimatizing itself.  Acclimatization is where our bodies produce more red blood cells and capillaries to carry more oxygen.  Our lungs will increase their size to facilitate osmosis of oxygen and carbon dioxide.  The vascular network of muscle, which enhances the transfer of gases, also increases.  

A facultative adaptation that our bodies do when going into higher altitudes is producing more hemoglobin to carry oxygen throughout our bodies.  In order to do this you would need to take an IRON vitamin.  Iron produces hemoglobin.  In doing this you are helping your body acclimate to high altitudes by not stressing the body to much to produce more blood cells and capillaries to carry the oxygen.  

Humans that is more likely to be able to develop in a high altitude area better than most is someone whose ancestors have lived at high altitudes for thousands of years.  Since some peoples ancestors lived in high altitudes for so long, they are usually genetically more suited for the stresses at high altitudes. The solution for the Indians in the high mountain valleys of Peru and Bolivia has been that they are able to produce more hemoglobin in their blood and to increase their lung expansion capability.  Both of these things results in an increase of oxygen that is carried by the blood.  Tibetans and Nepalese live in higher altitudes and they generally breathe faster in order to take in more oxygen and to have broader arteries and capillaries.  This allows an increased rate of blood flow and subsequently greater amounts of oxygen delivered throughout their bodies even though they have relatively low hemoglobin levels.

A cultural adaptation that many people who climb or hike to higher altitudes for enjoyment or to conquer a goal they have set for themselves, have started using oxygen tanks.  The oxygen tanks help them to breathe since they are experiencing hypoxia.  The oxygen allows them to climb to higher altitudes without experiencing severe hypoxia symptoms.  It also helps the body to not work as hard to produce more red blood cells and capillaries to carry more oxygen. 

One of the benefits of studying human variation from this perspective across environmental clines is that, researches believe that living in higher altitude can actually help people that need to lose weight, lose it!  Researches say this probably happens because higher altitudes cause decreased appetite and your body is burning more calories in the higher altitude than it would by working out.  I think this is good because there are a lot of people who would rather not work out but still eat unhealthy.  Eating unhealthy and being overweight is not good for our bodies and causes many health risks.  Even though being in a higher altitude also causes many health risks, I think that living in a higher altitude is productive for people who are overweight and need to lose the weight in order to become healthier.  Even though there are, health risks living in a higher altitude if your body acclimates properly you should be good. 

I would use race to understand the variation of the adaptations because it is in our genes and our ancestors culture as to why some humans have an easier time either living or adapting to high altitudes than others do.  If you trace back through history we would be able to figure out why the ancestors of the Indians in Peru and Bolivia chose to live in a higher altitude than settling everywhere else.  Race is traced back into almost everything if you think about it.  Every culture and race is different and has different ways of doing things and different beliefs.  There are races who believe in medicine men and medicine women to heal their wounded and sick.  Those cultures have their own truth and belief behind everything they do just like our culture does too.  Our ancestors settled where they did due to the reasons they have, that is why there are races that live in high altitudes and are able to handle that type of climate and there are races that cannot handle that climate and are not able to acclimate well.  So yes I would use race to understand the variation because I believe so many answers can be answered that way because of our ancestors history.

Language Blog week 7

Part 1: This was the easier of the two parts. While it was hard to keep a complex conversation going, because while my partner could convey complex concepts I could only respond in very simple terms. That forced my partner to do most of the talking. She found it very challenging to hold a conversation while trying to keep me involved as much as possible. She had to make complex questions have simple answers in order for me to communicate.

Clearly the people with a verbal language can convey the more complex ideas. To the that culture the ones who only spoke with gestures would be deemed inferior to the people with verbal language. it would also make people who spoke verbally not want to interact with the other culture. A group of people that would be in similar circumstances would be the deaf. While some could communicate with them using sign language most people do not know it resulting in the deaf having an extreme disadvantage. It is easy for the non deaf to communicate with those around them, but the deaf struggle to convey their intentions to people who do not speak sign language.

Part 2: This was the much harder part of the assignment. It is easy to not to talk, but to not be able to show body language made it hard to judge emotion. The only conversations that could be kept were ones of purely intellectual nature where emotion was not needed in order to explain fact, but unfortunately that did not last for the full 15 minutes. My partner was not able to get any real reaction out of me since I could not convey emotion.

Body language is extremely necessary to use body language in a conversation. Without it there is no way to show reaction and emotion without showing it. Conversation becomes bland and robotic and on top of that there is no sarcasm. How can I live without sarcasm? A group of people who may experience this would be the blind. While they still can hear alterations in tone and voice they are still at a huge disadvantage. Body language is necessary in order to know how to react to a person. If a person conveys sadness with their body it is often right response to reply with sympathy, but a person who could not see this, could not respond to it adequately. The only time that it is efficient to not show body language is when giving factual information.

The Piltdown man (early human) fossils were found in a gravel pit at piltdown, east Sussex, england in 1912 by Charles Dawson. During the time that the piltdown fossils were discovered that scientific community cheered greatly and accepted piltdown man as the missing link between apes and humans.Arthur Keith also cheered greatly when he heard about the piltdown fossils, because that provided him with the evidence he needed to prove his theory of human evolution. Charles Dawson and others involved were happy that now England had ancient human fossils of their very own.

The piltdown man hoax was discovered in the 1950's but clues leading to the discovery of the hoax's began in 1949 after world war 2, when new technology emerged that helped date fossils more accurately. In 1949 they began to measure the fluorine content of fossils scientists could get a better date on the fossils. When the piltdown man fossils were given a fluorine test the results showed the fossils were only one hundred thousand years old, instead of the millions of years old it would expected to be given the location were it was found. But it was in 1953 when a full series of scientific tests were conducted on the piltdown fossils, which lead to the exposure of the hoax. The testing showed that staining on the bones was superficial, that some of the engraves in the bones were craved with a steel knife after it was fossilized, and the more noticeable find was the teeth using a microscope they discovered that they teeth were filed down to make them look similar to the ware of human teeth. And the jaw bone found was dated less than 100 years old and came from a female  orangutan.  The discovery of the hoax put the scientific community into shock, they couldn't understand why anyone would create fake fossils. It also lead them down a path of confusing as they wondered why the piltdown man fossils wasn't similar to other early human fossils uncovered in other parts of the world. Arthur Woodward one of Charles Dawson's partners who assisted in the find was confused when he kept digging in piltdown for decades after Dawson died and couldn't find anything after Dawson passed away.

Being humans we all have faults which cause all of us to make mistakes whether they are intensional or not.  In this scenario, pride, and lack to details are some of the faults that were present. Lack of details occurred when they uncovered new early human fossils from different parts of the world they should have compared them to the piltdown discovery to see if there were any underlining similarities between the fossils which should have been present. Same basic jaw structure, teeth, and format of the skull would have been some basic things to look for when comparing the piltdown man and other early human fossils finding from different parts of the world. Pride was by far the biggest fault involved with this scenario, pride for his country and wanting to be recognized by the scientific community is what most say is the major motivation they say that Charles Dawson had to making the forgeries. He wanted to be accepted by the scientific community for his findings and also wanted England to have one of the earliest human fossils to ever be found he felt such discoveries would be England on top of the scientific community at the time. 

Scientific objection and testing of the original hypothesis is what lead to the finding of the piltdown man hoax, but not without the help of new emerging scientific technologies new fluorine testing and new discoveries with microscopes are some of the tools that enabled scientists to find the key clues that lead them to the truth. the Fluorine tests enabled them to test the natural level of fluorine in the fossils which in turn allowed them to calculate the date of the fossils.

There is not any way to completely remove human factor from science even if every factor of science was controlled by machines and computers they still require input from humans to do their calculations, and if we input something incorrectly into a computer then it shall not compute the given equations or function correctly.  no i wouldn't want to the human factor to be removed from science because although we make mistakes and mis calculations it allows us to fix problems by learning from our mistakes and expanding our knowledge.

The lesson I can take from this event is to be careful what I hear from people it doesn't matter who its from, but from any information I hear from someone else its always a good thing to do some back up research of your own just to verify that information you are receiving from someone else is credible and understandable.

Comparing Primates: (Sociality and Mating patterns)

Lemurs:

A.The lemurs are found in rainforests and are native to Madagascar. Some lemurs are nocturnal and they are usually found alone. Lemurs that are day dwellers are found in the trees or bushes. Some lemurs are herbivores. They eat plants, leaves, seeds and anything from the trees. There are some lemurs that are omnivores. Those Lemurs will eat lizards, insects, eggs of other animals and small mice.

B. They live in groups of 11-17 and the females are the dominant ones of the groups. If the groups gets bigger than 25 then they tend to break apart and start new groups. The females are sexually receptive for 2 days a year at the most. The breeding season for them is in May and can last for about 3 weeks and they obtain multiple partners during this time

C. The lemurs ability to swing swiftly from tree to tree they also jump from side to side while on the ground, which is not often, this forced adaptation to their environment helps them stay away from predators 

D. 

Spider Monkeys-

A. Spider Monkeys are found in tropical rain forests of Central, South America, Brazil and Mexico.

B. During the day, groups break up into subgroups of two to eight animals. The size of subgroups and the degree to which they avoid each other during the day depends on food competition and the risk of predation. Females rather than males disperse at puberty to join new groups. Males tend to stick together for their whole lives. Hence, males in a group are more likely to be related and have closer bonds than females. The strongest social bonds are formed between females and their young offspring.

C. Spider monkeys find food in the treetops and feast on nuts, fruits, leaves, bird eggs, and spiders.

D. 

     Baboon- 

     

    A. Baboons are found in a ton of different habitats and are extremely adaptable. They generally prefer semiarid habitats, like savannas, but some live in tropical forests. The major requirements for any habitat seem to be water sources and safe sleeping places—either in tall trees or on cliff faces.  Baboons are generally found in dry regions of Africa and Arabia.

B. Baboons are different they live in harems made up of one male and several females and their young. The males are fierce fighters and protect the group. Their group will typically include a younger male, but he will not attempt to mate with the females unless the older male is removed. In the harems of the Hamadryas baboons, the males jealously guard their females, to the point of grabbing and biting the females when they wander too far away. The hamadryas baboon is dependent on water, and is never found far from water sources. Their wild life expectancy is about 30 years. 

C. The males and females are bodily quite different from one another; the male's body could be twice as big as the female. The females have cyclical changes of the external genitalia which include swelling and redness and alert the male that they are sexually receptive. The baboons live in different kids of social groups; colobines live in small groups with very few males while the savanna baboons and most macaque species live in large social structures. Monogamy isn't something baboons practice.

D. 

Gibbon-

A. Gibbons are found in the forest of Southeast Asia.  The climate is warm, humid, and could be generally characterized as monsoonal.

B. The gibbon social structure looks a human marriage: a male, a female, and an offspring and raise their children together but are not necessarily monogamous.Unfortunately, food is a problem for this species making it difficult for this species to thrive. Their social and behavioral aspects of the gibbon has kept the gibbon producing offspring and essentially allowing the species to continue.

C. Gibbons thrive on the rich fruit trees in their tropical range, and are especially fond of figs. They will occasionally supplement their diet with leaves and insects. They are omnivore.

D. 

Chimpanzee- 

A. Chimpanzees live in social communities of several dozen animals, and can habituate themselves to African rain forests, woodlands, and grasslands.

B. After a 230 day pregnancy, female chimpanzees give birth to a single baby once every three or four years, which they will raise by themselves. The infants ride under the mother's body, until they are about 5 months old. Then they ride on the mother's back and leave their mothers after 6 years. 

Adult chimpanzees enjoy the social activity of grooming where they pick through each other’s hair to remove dirt particles. They occasionally fight among themselves, usually to establish their rank within the social group. They are also aggressive toward chimpanzees from other territories and will sometimes kill them.

C. Chimps have long arms, and when extended, they are about 1 ½ their body height. Their arms are longer than their legs. The bonobo is a little shorter and thinner than the common chimpanzee, but has longer limbs. Both species use their long, powerful arms for climbing in trees. Chimpanzees usually walk on all fours using their knuckles to support their bodies. Both the common chimpanzee and bonobo can walk upright on two legs when carrying objects with their hands and arms. The bonobo has proportionately longer upper limbs and tends to walk upright more often than the common chimpanzee. The face, fingers, palms of the hands, and soles of the feet are hairless. They do not have a tail. 

D. 

Summary: I think that after my research the lemur and spider monkey have more in common like the things they eat and their habitats. The Chimps, Baboon and Gibbons are more like a human, they eat a lot of the things that we eat and they also have very similar body types as we do. I think that they are all similar in many ways but like I mentioned before, the lemur and spider monkey are the least like a human in the ways they live and their life styles. 

DNA: TACACCTGCGAACGGAATCACGCAAACGGCTTG

historical Influences on Charles Darwin

1. I think that Alfred Russell Wallace had the most influence on Darwin's theory. His influence was a positive thing for Darwin because they believed in the same thing as one another. Wallace ended up sharing his theory and Darwin put it out in public before him for all the credit.

2. Wallace contributed to the scientific community by going our on expeditions to get the facts that he needed to support his hypothesis. He only told people what he knew what true and not what he thought was true.
http://blogs.scientificamerican.com/history-of-geology/2013/01/09/the-forgotten-naturalist-alfred-russel-wallace/

3. I think that "Organisms with better access to resources will be more successful in their reproductive efforts" is the one that most affected Wallace's work. He believed that whoever can get the most things that they need to live will be the ones that produce more and have more offspring. This influenced the theory by showing that animals with less resources are unable to have as many offspring. 

4. I don't think that Darwin could have developed the theory without the help of Wallace just because of the fact that there is so much thought and specific detail for one person to figure out on their own. he wouldn't have had it all correct if he didn't have any influence of Wallace helping him out.

5. People from the church believe Darwin but also believe that God made it this way for a reason. But, there were also people who were completely against it and thought he was going against God.